Input Format:

The input to this tool is a FASTA file containing one or more RNA sequences. Each sequence should follow the standard FASTA format:

FASTA Format Example:

>seq_1
GGGAGGGCGGGTGGG
>seq_2
GGGACTGGGCCCGGGTAAGGG

• Each sequence entry starts with a header line, beginning with the > symbol, immediately followed by a unique sequence identifier (SequenceID).
• The sequence is placed on the following line. Only RNA/DNA bases (A, T or U, G, C) should be included in the sequence.

Output Format:

The output of this tool will be a TSV (tab-separated values) file, where each row corresponds to one sequence from the input FASTA file. The output file will contain the following columns:

seq_id

The unique identifier of the RNA sequence, as provided in the input FASTA file.

sequence

The RNA sequence itself as extracted from the FASTA file.

G4mer

Column of G4mer score calculated for the sequence, which assess the likelihood of the sequence forming rG-quadruplex structures (rG4s).

Output example

seq_id        sequence                   G4mer
seq_1         GGGAGGGCGGGTGGG            0.997177004814148
seq_2         GGGACTGGGCCCGGGTAAGGG      0.9845851063728333

How to Use the Tool:

1. Upload/paste your FASTA file containing the RNA sequences of interest
2. Submit the file for analysis using the provided interface
3. View or download the output as a TSV file, which will include the G4mer score for each sequence